Workflow Type: Galaxy

ChIP-seq single-read Workflow

Inputs dataset

  • The workflow needs a single input which is a list of fastqsanger files.

Inputs values

  • adapters sequence_forward: this depends on the library preparation. If you don't know, use FastQC to determine if it is Truseq or Nextera.
  • reference_genome: this field will be adapted to the genomes available for bowtie2.
  • effective_genome_size: this is used by MACS2 and may be entered manually (indications are provided for heavily used genomes).

Processing

  • The workflow will remove illumina adapters and low quality bases and filter out any read smaller than 15bp.
  • The filtered reads are mapped with bowtie2 with default parameters.
  • The BAM is filtered to keep only MAPQ30.
  • The peaks are called with MACS2 with a fixed extension of 200bp which at the same time generates a coverage file.
  • The coverage is converted to bigwig.
  • A MultiQC is run to have an overview of the QC.

Warning

  • The coverage output is not normalized.
  • The filtered bam still has PCR duplicates which are removed by MACS2.

Inputs

ID Name Description Type
SR fastq input #main/SR fastq input Should be a collection with ChIPseq fastqs
  • array containing
    • File
adapter_forward #main/adapter_forward Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
  • string
effective_genome_size #main/effective_genome_size Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000
  • int
reference_genome #main/reference_genome reference_genome
  • string

Steps

ID Name Description
4 Cutadapt (remove adapter + bad quality bases) toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy0
5 Bowtie2 map on reference toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.4.5+galaxy1
6 filter MAPQ30 toolshed.g2.bx.psu.edu/repos/devteam/samtool_filter2/samtool_filter2/1.8+galaxy1
7 Call Peaks with MACS2 toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.7.1+galaxy0
8 summary of MACS2 summary of MACS2 toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1
9 Bigwig from MACS2 wig_to_bigWig
10 MultiQC toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy0

Outputs

ID Name Description Type
MACS2 narrowPeak #main/MACS2 narrowPeak n/a
  • File
MACS2 peaks #main/MACS2 peaks n/a
  • File
MACS2 report #main/MACS2 report n/a
  • File
MACS2 summits #main/MACS2 summits n/a
  • File
MultiQC on input dataset(s): Stats #main/MultiQC on input dataset(s): Stats n/a
  • File
MultiQC webpage #main/MultiQC webpage n/a
  • File
coverage from MACS2 #main/coverage from MACS2 n/a
  • File
filtered BAM #main/filtered BAM n/a
  • File
mapping stats #main/mapping stats n/a
  • File

Version History

v0.15 (latest) Created 31st Jul 2025 at 03:02 by WorkflowHub Bot

Updated to v0.15


Frozen v0.15 fad5aba

v0.14 Created 26th Mar 2025 at 09:52 by WorkflowHub Bot

Updated to v0.14


Frozen v0.14 64f1c18

v0.13 Created 7th Feb 2025 at 03:02 by WorkflowHub Bot

Updated to v0.13


Frozen v0.13 7060e93

v0.12 Created 7th Oct 2024 at 16:33 by WorkflowHub Bot

Updated to v0.12


Frozen v0.12 7605642

v0.8 Created 7th Oct 2024 at 16:33 by WorkflowHub Bot

Updated to v0.8


Frozen v0.8 1d6df89

v0.7 Created 7th Oct 2024 at 16:33 by WorkflowHub Bot

Updated to v0.7


Frozen v0.7 cb80ed9

v0.6 Created 7th Oct 2024 at 16:33 by WorkflowHub Bot

Updated to v0.6


Frozen v0.6 835ae56

v0.11 Created 16th Jul 2024 at 03:02 by WorkflowHub Bot

Updated to v0.11


Frozen v0.11 dada755

v0.10 Created 30th May 2024 at 11:35 by WorkflowHub Bot

Updated to v0.10


Frozen v0.10 0a16026

v0.9 Created 30th Apr 2024 at 03:02 by WorkflowHub Bot

Updated to v0.9


Frozen v0.9 924fbb6

v0.5 Created 18th Oct 2023 at 03:01 by WorkflowHub Bot

Updated to v0.5


Frozen v0.5 56e6f3b

v0.4 Created 1st Sep 2023 at 03:01 by WorkflowHub Bot

Updated to v0.4


Frozen v0.4 1a21f69

v0.3 Created 14th Jan 2023 at 03:01 by WorkflowHub Bot

Updated to v0.3


Frozen v0.3 906ba40

v0.2 Created 29th Nov 2022 at 03:01 by WorkflowHub Bot

Updated to v0.2


Frozen v0.2 97c1b8e

v0.1 (earliest) Created 21st Oct 2022 at 03:01 by WorkflowHub Bot

Updated to v0.1


Frozen v0.1 8963174
help Creators and Submitter
Creator
  • Lucille Delisle
Additional credit

Lucille Delisle

Submitter
License
Activity

Views: 13979   Downloads: 10287   Runs: 0

Created: 21st Oct 2022 at 03:01

Last updated: 20th Aug 2025 at 10:23

help Tags
help Attributions

None

Total size: 36.6 KB
Powered by
(v.1.17.0-main)
Copyright © 2008 - 2025 The University of Manchester and HITS gGmbH