Workflow Type: Galaxy

This workflow takes as input a list of single-end fastqs. Adapters and bad quality bases are removed with fastp. Reads are mapped with STAR with ENCODE parameters and genes are counted simultaneously as well as normalized coverage (per million mapped reads) on uniquely mapped reads. The counts are reprocessed to be similar to HTSeq-count output. Alternatively, featureCounts can be used to count the reads/fragments per gene. FPKM are computed with cufflinks and/or with StringTie. The unstranded normalized coverage is computed with bedtools.

Inputs

ID Name Description Type
Collection of FASTQ files Collection of FASTQ files Should be a list of single-read RNA-seq fastqs
  • File[]
Compute Cufflinks FPKM Compute Cufflinks FPKM Whether FPKM values should be computed with Cufflinks
  • boolean
Compute StringTie FPKM Compute StringTie FPKM Whether FPKM values should be computed with StringTie
  • boolean
Forward adapter Forward adapter This is optional. If not provided, fastp will try to guess the sequence. If you want to specify, for Nextera use: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC, for TruSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
  • string?
GTF file of annotation GTF file of annotation GTF compatible with the reference genome. Mind the UCSC/Ensembl differences in chromosome naming.
  • File
GTF with regions to exclude from FPKM normalization with Cufflinks GTF with regions to exclude from FPKM normalization with Cufflinks It could be a GTF with for example one entry for the chrM forward and one entry for the chrM reverse
  • File?
Generate additional QC reports Generate additional QC reports Whether to compute additional QC like fastQC, gene body coverage etc...
  • boolean
Reference genome Reference genome Select the reference genome
  • string
Strandedness Strandedness For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence
  • string
Use featureCounts for generating count tables Use featureCounts for generating count tables Use featureCounts tool instead of RNA STAR?
  • boolean

Steps

ID Name Description
10 remove adapters + bad quality bases toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.24.0+galaxy3
11 no additional QC toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0
12 get reference_genome as text parameter toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1
13 Get featureCounts strandedness parameter toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0
14 Get cufflinks strandedness parameter toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0
15 Get Stringtie strandedness parameter toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0
16 STAR: map and count and coverage splitted toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.11a+galaxy1
17 Generate Unstranded Coverage n/a
18 Generate Stranded Coverage n/a
19 featureCounts toolshed.g2.bx.psu.edu/repos/iuc/featurecounts/featurecounts/2.0.3+galaxy2
20 Compute FPKM with StringTie toolshed.g2.bx.psu.edu/repos/iuc/stringtie/stringtie/2.2.3+galaxy0
21 Compute FPKM with cufflinks toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.4
22 Process Count files n/a
23 Combined MultiQC without additional QC toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0
24 Combined MultiQC Quality Report n/a

Outputs

ID Name Description Type
Mapped Reads Mapped Reads n/a
  • File
Unstranded Coverage Unstranded Coverage n/a
  • File
Stranded Coverage Stranded Coverage n/a
  • File
Gene Abundance Estimates from StringTie Gene Abundance Estimates from StringTie n/a
  • File
Transcripts Expression from Cufflinks Transcripts Expression from Cufflinks n/a
  • File
Genes Expression from Cufflinks Genes Expression from Cufflinks n/a
  • File
Counts Table Counts Table n/a
  • File
Small MultiQC stats Small MultiQC stats n/a
  • File
Small MultiQC HTML report Small MultiQC HTML report n/a
  • File
MultiQC HTML report MultiQC HTML report n/a
  • File
MultiQC stats MultiQC stats n/a
  • File

Version History

v1.2 (latest) Created 29th Jan 2025 at 03:02 by WorkflowHub Bot

Updated to v1.2


Frozen v1.2 4dfaa02

v1.1 Created 26th Nov 2024 at 03:02 by WorkflowHub Bot

Updated to v1.1


Frozen v1.1 49929d3

v1.0 Created 20th Nov 2024 at 03:02 by WorkflowHub Bot

Updated to v1.0


Frozen v1.0 96e4475

v0.9 Created 7th Oct 2024 at 16:32 by WorkflowHub Bot

Updated to v0.9


Frozen v0.9 26e44e5

v0.6 Created 7th Oct 2024 at 16:32 by WorkflowHub Bot

Updated to v0.6


Frozen v0.6 2465702

v0.8 Created 16th Jul 2024 at 03:02 by WorkflowHub Bot

Updated to v0.8


Frozen v0.8 ee9034e

v0.7 Created 29th Jun 2024 at 03:02 by WorkflowHub Bot

Updated to v0.7


Frozen v0.7 59f2b7e

v0.5 Created 16th Sep 2023 at 03:01 by WorkflowHub Bot

Updated to v0.5


Frozen v0.5 ac353d9

v0.4.1 Created 15th Sep 2023 at 03:01 by WorkflowHub Bot

Updated to v0.4.1


Frozen v0.4.1 5228c14

v0.4 Created 17th Jan 2023 at 03:01 by WorkflowHub Bot

Updated to v0.4


Frozen v0.4 f49c5a7

v0.2 Created 1st Dec 2022 at 03:01 by WorkflowHub Bot

Updated to v0.2


Frozen v0.2 28b9493

v0.1 (earliest) Created 22nd Oct 2022 at 03:01 by WorkflowHub Bot

Updated to v0.1


Frozen v0.1 30a19f3
help Creators and Submitter
Creator
  • Lucille Delisle
Additional credit

Lucille Delisle

Submitter
License
Activity

Views: 12339   Downloads: 11933   Runs: 3

Created: 22nd Oct 2022 at 03:01

Last updated: 17th Jan 2023 at 03:01

help Tags
help Attributions

None

Total size: 178 KB
Powered by
(v.1.17.0-main)
Copyright © 2008 - 2025 The University of Manchester and HITS gGmbH