Workflow Type: Galaxy
Frozen
This workflow takes as input a list of single-end fastqs. Adapters and bad quality bases are removed with fastp. Reads are mapped with STAR with ENCODE parameters and genes are counted simultaneously as well as normalized coverage (per million mapped reads) on uniquely mapped reads. The counts are reprocessed to be similar to HTSeq-count output. Alternatively, featureCounts can be used to count the reads/fragments per gene. FPKM are computed with cufflinks and/or with StringTie. The unstranded normalized coverage is computed with bedtools.
Inputs
| ID | Name | Description | Type |
|---|---|---|---|
| Collection of FASTQ files | Collection of FASTQ files | Should be a list of single-read RNA-seq fastqs |
|
| Compute Cufflinks FPKM | Compute Cufflinks FPKM | Whether FPKM values should be computed with Cufflinks |
|
| Compute StringTie FPKM | Compute StringTie FPKM | Whether FPKM values should be computed with StringTie |
|
| Forward adapter | Forward adapter | This is optional. If not provided, fastp will try to guess the sequence. If you want to specify, for Nextera use: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC, for TruSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC |
|
| GTF file of annotation | GTF file of annotation | GTF compatible with the reference genome. Mind the UCSC/Ensembl differences in chromosome naming. |
|
| GTF with regions to exclude from FPKM normalization with Cufflinks | GTF with regions to exclude from FPKM normalization with Cufflinks | It could be a GTF with for example one entry for the chrM forward and one entry for the chrM reverse |
|
| Generate additional QC reports | Generate additional QC reports | Whether to compute additional QC like fastQC, gene body coverage etc... |
|
| Reference genome | Reference genome | Select the reference genome |
|
| Strandedness | Strandedness | For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence |
|
| Use featureCounts for generating count tables | Use featureCounts for generating count tables | Use featureCounts tool instead of RNA STAR? |
|
Steps
| ID | Name | Description |
|---|---|---|
| 10 | remove adapters + bad quality bases | toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.24.0+galaxy3 |
| 11 | no additional QC | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0 |
| 12 | get reference_genome as text parameter | toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1 |
| 13 | Get featureCounts strandedness parameter | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0 |
| 14 | Get cufflinks strandedness parameter | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0 |
| 15 | Get Stringtie strandedness parameter | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0 |
| 16 | STAR: map and count and coverage splitted | toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.11a+galaxy1 |
| 17 | Generate Unstranded Coverage | n/a |
| 18 | Generate Stranded Coverage | n/a |
| 19 | featureCounts | toolshed.g2.bx.psu.edu/repos/iuc/featurecounts/featurecounts/2.0.6+galaxy0 |
| 20 | Compute FPKM with StringTie | toolshed.g2.bx.psu.edu/repos/iuc/stringtie/stringtie/2.2.3+galaxy0 |
| 21 | Compute FPKM with cufflinks | toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.4 |
| 22 | Process Count files | n/a |
| 23 | Combined MultiQC without additional QC | toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0 |
| 24 | Combined MultiQC Quality Report | n/a |
Outputs
| ID | Name | Description | Type |
|---|---|---|---|
| Mapped Reads | Mapped Reads | n/a |
|
| Unstranded Coverage | Unstranded Coverage | n/a |
|
| Stranded Coverage | Stranded Coverage | n/a |
|
| Gene Abundance Estimates from StringTie | Gene Abundance Estimates from StringTie | n/a |
|
| Transcripts Expression from Cufflinks | Transcripts Expression from Cufflinks | n/a |
|
| Genes Expression from Cufflinks | Genes Expression from Cufflinks | n/a |
|
| Counts Table | Counts Table | n/a |
|
| Small MultiQC stats | Small MultiQC stats | n/a |
|
| Small MultiQC HTML report | Small MultiQC HTML report | n/a |
|
| MultiQC HTML report | MultiQC HTML report | n/a |
|
| MultiQC stats | MultiQC stats | n/a |
|
Version History
v0.1 (earliest) Created 22nd Oct 2022 at 03:01 by WorkflowHub Bot
Updated to v0.1
Frozen
v0.1
30a19f3
Creators and SubmitterCreator
Additional credit
Lucille Delisle
Submitter
License
Activity
Views: 16899 Downloads: 61247 Runs: 3
Created: 22nd Oct 2022 at 03:01
Last updated: 17th Jan 2023 at 03:01
Annotated Properties
Scientific disciplines
Computer Science
Tags
AttributionsNone
View on GitHub
Run on Galaxy
Tests